Caroline6640 Caroline6640
  • 03-02-2020
  • History
contestada

What was hawaii called when europeans first discovered it?

Respuesta :

abbythe21 abbythe21
  • 03-02-2020

Answer:

I think it is Oahu

Explanation:

I did a test for it

Answer Link

Otras preguntas

Is water access to water desalination equal across the region? Please answer! Thank you.
Graph 3 < 2 Answer quickly please <3
Can someone help me plss tyy!
What's the most rebellious thing you've ever done? Did you get un trouble for it?​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Which set or sets does the number -3 belong to? interger, rational ,whole numbers
Which is a true statement about money market accounts, checking accounts, certificates of deposit, and savings accounts? A. They can all be linked to financial
Please help serious answers only
2. How is mass different from weight Help please
4. Gloria the grasshopper is working on her hops. She is trying to jump as high and as far as she can. Her best jump so far was 28 cm long, and she reached a h