marlenelopezmedel285 marlenelopezmedel285
  • 02-01-2020
  • History
contestada

What is the declarations of the rights of man?

Respuesta :

jhu4w jhu4w
  • 02-01-2020

Answer: The Declaration of the Rights of Man and of the Citizen (French: Déclaration des droits de l'homme et du citoyen de 1789), set by France's National Constituent Assembly in 1789, is a human civil rights document from the French Revolution.

Explanation:

Answer Link

Otras preguntas

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
Which statement is true? a. Kush was located in modern-day Egypt. b. Kush was conquered by Aksum. c. Kush never controlled Egypt. d. Kush was invaded by Rome.
how to write a hook for a song essay
it is not important to develop effective communication skills. T or F
How do you evaluate 5+x+12
Who usually benefits the most from gerrymandering congressional districts?
Katie borrowed $2,500 at 10% simple interest for 5 years. What was the total interest? $12.50 $125.00 $1,250.00 $12,500.00
Llena el espacio con la palabra correcta. Word Bank: me, te, le, nos, les. Él _________a0 pregunta la dirección. (a Ud.)
What is the transfer of genetic instructions in dna to mrna?
Which of the following taxes are charged on items at the time of purchase?