princetonporter
princetonporter princetonporter
  • 13-06-2016
  • English
contestada

What is the meaning of the term carpe diem?

Respuesta :

davidcondreyjr21
davidcondreyjr21 davidcondreyjr21
  • 13-06-2016
the correct answer is exclamation
Answer Link
dubstepchick04 dubstepchick04
  • 13-06-2016
Carpe diem translates from Latin to English,as seize the day
Answer Link

Otras preguntas

one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Did feudalism create a stable form of government?
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?