Charyjuic2kl0e Charyjuic2kl0e

11-05-2016
Mathematics

contestada

What is the next number in the following series 3, 15, 35, 63?

Respuesta :

rzajac11 rzajac11

11-05-2016

99

3 = 1*3
15= 3*5
35= 5*7
63= 7*9
99=9*11

Answer Link

Otras preguntas

Sonja is 42 years old and pregnant with her first child. Her doctor thinks she ought to have a procedure called amniocentesis to harvest fetal cells for genetic

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Why did the South rebel against the Union

What were some popular subjects of medieval writers?

which western state has an involvement in the space industrya. Oregon b. Washington c. California d.idaho

Can anyone do this ??

7. What is the theoretical probability of a player winning a small prize, given this game setup? HELPPPPP!!!!!!!!!!

What was the opinion of Martin Luther King Jr. about Vietnam war?

Which type of waves cannot travel through a vacuum visible light waves x-ray waves gamma ray ray waves or sound waves

L is for pricly leaves l is for smooth leaves What are the possible genotypes of an organism with pricly leaves? Choose all that apply. Question 8 options: ll l