Kenzietefaze9stoliv
Kenzietefaze9stoliv Kenzietefaze9stoliv
  • 02-05-2016
  • Social Studies
contestada

Predicting how do you think people today would accept solons ruling that sons follow fathers in their life's work

Respuesta :

WorldCitizen WorldCitizen
  • 06-05-2016
Just imagine how you would feel if you were forced to do the same job as your parents (imagine that you have different interests than them): you would feel that your freedom is being taken away and that you're not achieving your full potential and happiness: I believe that is what people would think today and they would reject this ruling
Answer Link

Otras preguntas

Best pick up line gets brainliest :)
Hydrogen reacts with iodine to form hydrogen iodide: H2[g] + 12[g] = 2H1[g] The forward reaction is endothermic. The reaction reaches equilibrium. Which of the
Which is it, true or false?
The daily wages of a carpenter are increased from $40 to $48. Find the percent increase?
How did the Civil War help the cause of women suffrage
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
11=3−4/3x solve for x
Criteria description​
What is the name of the area around a charged object where the object can exert a force on other charged objects? A) electric field B) electric charge C) electr
can you do this for me - correct answer gets brainliest!