solaric
solaric solaric
  • 03-02-2019
  • English
contestada

Is "words dying" personification? Please help! thanks

Respuesta :

eldercunningham eldercunningham
  • 03-02-2019
words dying I believe is personification since it is giving human characteristics to something that isnt human

Answer Link

Otras preguntas

In a research study by Jeng et al., (2000), what percentage of very-low-birth-weight (VLBW) infants were walking by 18 months of age?a.50%b.89%c.100%d.It depend
According to the Federal Sentencing Guidelines for Organizations, six basic elements are important to a complete ethics and compliance program. Which of the fol
Does sarada like boruto
joe owns a sandwich shop.He changes $10.00 for two sandwiches and one drink and $6.50 for one sandwich and one drink.How much does joe charge per sandwich?How m
Five plus three equals
For n = 2d squared - 5 when d = -2nwhat does n equal
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
given tan(theta)= -2 and pi/2 < theta < pi; find cos theta)
Find the missing length indicated.
Rewrite the expression 2(30 + 5) using the distributive property of multiplication over addition