crystalluvzjaw
crystalluvzjaw crystalluvzjaw
  • 02-11-2018
  • Chemistry
contestada

A rover is an orbiting spacecraft that acts as a lab where astronauts can live and work for longer periods of time
true
false

Respuesta :

Student9900
Student9900 Student9900
  • 02-11-2018

false

because a rover is a robot than was sent to space to

explore something.

Answer Link

Otras preguntas

You can calculate triangle area when you know all three sides by using Heron's Formula. You can also use a formula discovered by the Chinese which I found in W
What did Theodore Roosevelt do before he was elected president at the age of 42?
At age 76 years, which chronic condition is elizabeth most likely to have?
Help with geometry!!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Pls answer this question
You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per
Can things of aluminum have a greater mass than things made of iron?
What is the elapsed time
A book with 30 pages has 21 pages with printing, 5 pages with printing and pictures, and 4 pages that are blank. What is the theoretical probability of opening