nicholeashleyy27 nicholeashleyy27
  • 13-09-2018
  • Mathematics
contestada

what are the coordinates of A’ in quadrilateral A’B’C’D’

what are the coordinates of A in quadrilateral ABCD class=

Respuesta :

shadowpup0401
shadowpup0401 shadowpup0401
  • 13-09-2018

The coordinates of A is (-1, 2)

You just first move over to the left on the X axis making your x coordinate a negative. So when you you get to -1 you go up to where A is, which is at positive 2. Your y coordinate is positive because you're moving up on the Y axis and not down.

Answer Link
Аноним Аноним
  • 13-09-2018

cordanite a is (-1,2)

Answer Link

Otras preguntas

how would u form a superlative for the adverb widely
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Please help solve, thanks in advance!
How many times does four go into 153 ? What Is the remainder ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are 2 points on the graph for 6x-5y=25
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
How do you put allele in a sentence
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t