dhrgsgrgr7394 dhrgsgrgr7394
  • 11-09-2018
  • Biology
contestada

What is the greatest difference in hydrogen and hydroxide ions?

Respuesta :

Netta00 Netta00
  • 20-09-2018

H+ is positive and OH- is negative. When you put the charge with the name, it becomes quite clear. Only on certain occasions can hydrogen atoms become negatively charged but hydrogen usually loses electrons.


Answer Link

Otras preguntas

4.2meters= how many centimeter
Please answer theses division problems!! 9 divided by 3/7
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
What are some methods used by Mussolini to rise to power?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
the reproductive system of a male mammal provides
Where did middle names come from
what are 2 points on the graph for 6x-5y=25