YeemoMoon YeemoMoon
  • 13-08-2018
  • Mathematics
contestada

62 divided by 310,long divison

Respuesta :

mugeemerve
mugeemerve mugeemerve
  • 13-08-2018

62 (divisor) :310(dividend)

Answer is 005

Answer Link

Otras preguntas

What is one function that both nafta and the eu have in common
According to nietzsche, all values are _____ . ultimately based on facts chosen worthwhile inherited
Find vertical and horizontal asymtope for (x^2+2x-48)/x+8
(SPANISH) NEED HELP 100 POINTS I WILL MARK BRAINLIEST AND SAY THANK YOU SERIOUS ANSWERS ONLY Create a public service announcement in Spanish on severe weather p
The four main systems of the Earth are
the seneca falls convention was the beginning of what
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
Ms. Edwards is redecorating her office. She has a choice of 6 colors of paint, 3 kinds of curtains, and 4 colors of carpet. How many different ways are there to
Emotional responses to a traumatic event are most directly under the control of the
For a material that contains n atoms, how many electron states will there be in a p band