unicornlover708 unicornlover708

02-03-2016
Physics

contestada

If i threw a ball vertically at an initial speed of 34.5 m/s^2, how many seconds would it take to reach its maximum height

Respuesta :

NitroNida NitroNida

02-03-2016

It would take 3.8 seconds to reach its maximum height.

Answer Link

Otras preguntas

A system of three linear equations in three variables is consistent and dependent. How many solutions to the system exist? Onone Oone Othree O infinitely many

Which expressions are equivalent to 5+(-3)(6x-5)

what is the value of the following Expression 3 * [8 + 12 ÷ (1 + 2)] + 2 * 5

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

What type of interest rates will a person with a credit score in the low to below 600 range be offered for a loan? A. zero interest rates B. will never get a lo

Question 1 of 10 Which of the following best describes what a manager does?

Elige el pronombre o adjetivo relativo apropiado. La herida por __________________ me perdí la carrera me duele mucho. El teatro ___________________ fui era rea

Part A: The area of a square is (16x2 − 8x + 1) square units. Determine the length of each side of the square by factoring the area expression completely. Show

Determine whether AB and CD are parallel, perpendicular, or neither for A (-1,-1), B (1,5), C (1,2), D (5,4). Graph each line to verify your answer.

PLEASE HELP DUE SOON WILL GIVEBRAINLIEST (01.10 HC) Read the following excerpt from the poem "Wynken, Blynken, and Nod" by Eugene Field. Then, respond to the qu