saigelthegreat8720 saigelthegreat8720

03-06-2018
Mathematics

contestada

Find the least common multiple of these two expressions 8v^5w^8 and 14

Respuesta :

jaredanderson jaredanderson

06-06-2018

true..............................................

Answer Link

Otras preguntas

Which of the following inequalities matches the graph? A) x < 2 B) y > 2 C) y < 2 D) x > 2

How is an online bank different from a retail bank?

Emily buys a pack of 12 bottles of water the pack cost £5.64. Emily sells all 12 bottles for 50p each.Work out Emily's percentage profit.Give your awnser correc

Mike is a great football player. last saturday, his new girlfriend attended the game to watch him play, and mike played even better than usual. mike's enhanced

Why did antislavery activists angelina grimké, sarah grimké, and maria stewart encounter hostility in the north? a. no one was receptive to the substance of the

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

a rectangle measures 3 yards by 4 feet. what is the perimeter of the rectangle in inches show your work

If a child belonged to blood type o, he or she could not have been produced by which set of parents? a. type a mother and type o father b. type ab mother and ty

“ to run up the stairs the student must work against the force of ....”

The seafloor spreads at a rate of approximately 10 cm per year. If you were to collect data on the spread of the seafloor each week, which unit should you use t