wisdommoss3771 wisdommoss3771
  • 15-04-2024
  • Social Studies
contestada

Most U.S. adults become grandparents at what age?
a) Late 70s and early 80s
b) Late 50s and early 60s
c) Late 40s and early 50s
d) Late 60s and early 70s

Respuesta :

Otras preguntas

Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
How well did feudalism establish order in the Middle ages?
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
p(x) x^3+x^2-x-1 Find all zeros of p (x)