LillyNguyen3139 LillyNguyen3139
  • 12-04-2024
  • Mathematics
contestada

Minimize C=6x+7y subject to 4x+y≥40 ,2x+y≥30 ,x+3y≥30 ,x≥0,y≥0. The minimum is C= at (x,y)=(,).

Respuesta :

Otras preguntas

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
Liam buys some fruit for £26.55. He pays the exact amount using two notes and four coins.List the notes and coins Liam could have used.​
A​ country's education department reported that in 2015​, 64.8​% of students enrolled in college or a trade school within 12 months of graduating high school. I
Why did Thomas Jefferson feel it was important to express his view of democracy in his first inaugural address?
What impact can family therapy have on a family with an alcoholic member?
A car uses 9 litres of petrol to travel 80 km. Petrol costs £1.35 How much does it cost to travel 400 km? per litre.
The Noble gas with the biggest atomic radius A- Helium B- Neon C- Argon D- Krypton
Cakes or cupcakes: which is a better choice for your wedding? Which is the best evaluative thesis for the prompt? O Wedding cupcakes are often cheaper than cak
Write 2 quadratic equations (of any form) that are not equivalent, each with a vertex of (4,5).
A person 1.85 m tall walks towards a lamppost on level ground at a rate of 0.5 m/sec. The lamp on the post is 5 m high. At which rate is the tip of the person's