Ho1yVib3Z Ho1yVib3Z

14-01-2021
Physics

contestada

How is light bent when light is going from a less dense medium to a denser medium?

A) away from the normal line
B) towards the normal line
C) towards the reflecting surface

Respuesta :

niyah6259 niyah6259

14-01-2021

C
Explanation TRUST MEE !

Answer Link

Nicole1234512 Nicole1234512

14-01-2021

Answer:

C: towards the reflecting surface

Explanation:

this is also known as refraction of light. Hope this helps!

Answer Link

Otras preguntas

A train goes twice as fast downhill as it can go uphill, and 2/3 feet as fast uphill as it can go on level ground. if it goes 120 miles per hour downhill, how l

6 cm 4 cm 10 cm What is the area of the figure in square centimeters? TOTAL AREA= find the area of all the shapes and ADD together. To find the area 1/2 of a ci

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Theequation ^4 +^3 −−1=0a. Has four unequal complex rootsb. Has two equal real roots and two equal complex rootsc. Has two unequal real roots and two unequal co

Find the conditional relative frequency that a student surveyed prefers cats as pets, given that the student is a girl

The center of the circle below is at P. If the angle < APB measures 48 °, and the radius is 8 cm., find the length of the arc AB in cm.. (round to the neares

f(x) = x +4g(x) = 3x2 – 7Find (f .g)(x).A. (f-9)(x) = 3.73 – 28O B. (f.g)(x) = 3x2 + 12x2 – 7x - 28OC. (f.g)(x) = 3.r3 +28O D. (f.g)(x) = 3.7° + 12.2 - 72 +28

Please be clear with the answer thank you bye-bye bye-bye

Andrea, Ben, Christine, and Doug all live on the same street as their school. The street runs from east to west.Andrea lives 5 1/2 blocks to the west of school.

Can you please help me